ID: 900991535_900991546

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 900991535 900991546
Species Human (GRCh38) Human (GRCh38)
Location 1:6100434-6100456 1:6100468-6100490
Sequence CCTGCTTCCTTCCCGGACAGGGT CAATGGTGCCAGAGGGCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 114, 4: 1584} {0: 1, 1: 0, 2: 2, 3: 28, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!