ID: 900996622_900996630

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900996622 900996630
Species Human (GRCh38) Human (GRCh38)
Location 1:6126502-6126524 1:6126520-6126542
Sequence CCCTGACAGAATCCTGCCCCACC CCACCCTCCGCCTCTGGGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 13, 4: 214} {0: 1, 1: 1, 2: 3, 3: 17, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!