ID: 900996622_900996641

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 900996622 900996641
Species Human (GRCh38) Human (GRCh38)
Location 1:6126502-6126524 1:6126554-6126576
Sequence CCCTGACAGAATCCTGCCCCACC CTCCCTCCCGGCACGCACCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 13, 4: 214} {0: 1, 1: 0, 2: 1, 3: 65, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!