ID: 901012580_901012583

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 901012580 901012583
Species Human (GRCh38) Human (GRCh38)
Location 1:6209920-6209942 1:6209957-6209979
Sequence CCAGGACAGGCTGGCAGAGAGGA CAGGCTGTGCAGAGGTGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 388} {0: 1, 1: 0, 2: 3, 3: 61, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!