ID: 901037842_901037847

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 901037842 901037847
Species Human (GRCh38) Human (GRCh38)
Location 1:6347049-6347071 1:6347072-6347094
Sequence CCAGCCAGAGACAGAACCTTGGG ACTTCCAGCCACAGACTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 174} {0: 1, 1: 0, 2: 2, 3: 16, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!