ID: 901042537_901042550

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901042537 901042550
Species Human (GRCh38) Human (GRCh38)
Location 1:6374200-6374222 1:6374225-6374247
Sequence CCCACGTCCCTCAGCCCAAACAG GCGGGAGGGAGGTGGCCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148} {0: 1, 1: 0, 2: 2, 3: 30, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!