ID: 901061175_901061183

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901061175 901061183
Species Human (GRCh38) Human (GRCh38)
Location 1:6472608-6472630 1:6472633-6472655
Sequence CCGCCGGGTCAGCTTCTAGAGGG GGCAGGATGGGTCATTCACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78} {0: 1, 1: 0, 2: 0, 3: 4, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!