ID: 901061394_901061404

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901061394 901061404
Species Human (GRCh38) Human (GRCh38)
Location 1:6473510-6473532 1:6473535-6473557
Sequence CCCCAGGGCGGGTTTCCAGGGCC AGGCCAGCCTGGGATGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 178} {0: 1, 1: 0, 2: 7, 3: 87, 4: 740}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!