ID: 901068570_901068576

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 901068570 901068576
Species Human (GRCh38) Human (GRCh38)
Location 1:6506213-6506235 1:6506228-6506250
Sequence CCTGGGGACGGGACGCAGGGAGT CAGGGAGTGCAGGGGCGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 19, 4: 159} {0: 1, 1: 0, 2: 3, 3: 52, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!