ID: 901068830_901068839

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 901068830 901068839
Species Human (GRCh38) Human (GRCh38)
Location 1:6507383-6507405 1:6507419-6507441
Sequence CCATGGGGCAGCCCTTCAGAAAT GGGCCAAGGGCAGCTTGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 186} {0: 1, 1: 0, 2: 1, 3: 22, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!