ID: 901083627_901083642

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 901083627 901083642
Species Human (GRCh38) Human (GRCh38)
Location 1:6597602-6597624 1:6597646-6597668
Sequence CCCTGTTCTTCTTGGTGCTCACT TCCTGTCTGGGGGGATGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 236} {0: 1, 1: 0, 2: 2, 3: 39, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!