ID: 901086674_901086690

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 901086674 901086690
Species Human (GRCh38) Human (GRCh38)
Location 1:6615038-6615060 1:6615072-6615094
Sequence CCCGCACCTTCGGGGGCCGAGTG GGCTGCCGCGGGAGGGCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 245, 4: 6728} {0: 1, 1: 1, 2: 5, 3: 91, 4: 676}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!