ID: 901127852_901127862

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 901127852 901127862
Species Human (GRCh38) Human (GRCh38)
Location 1:6941803-6941825 1:6941841-6941863
Sequence CCAGCCAGCAGTGCCTGGGATGG GTCCACTATAGGCATGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 324} {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!