ID: 901167144_901167154

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 901167144 901167154
Species Human (GRCh38) Human (GRCh38)
Location 1:7229129-7229151 1:7229171-7229193
Sequence CCTGGGGCAGAGGAGGGAGAGTG CTGAGAGAGCTCTAGGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 116, 4: 1081} {0: 1, 1: 0, 2: 1, 3: 20, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!