ID: 901201267_901201277

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 901201267 901201277
Species Human (GRCh38) Human (GRCh38)
Location 1:7468751-7468773 1:7468802-7468824
Sequence CCATGGTTCTACTTTCTGTTGTT GTTTAGGGATCTCTCTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 89, 4: 701} {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!