ID: 901215213_901215230

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 901215213 901215230
Species Human (GRCh38) Human (GRCh38)
Location 1:7551137-7551159 1:7551175-7551197
Sequence CCTCCTGGTCTCCACCCCAGTCT TGGGGCTTCCCTGCCCAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 413} {0: 1, 1: 1, 2: 4, 3: 40, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!