ID: 901217448_901217451

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 901217448 901217451
Species Human (GRCh38) Human (GRCh38)
Location 1:7562773-7562795 1:7562792-7562814
Sequence CCCACTTCTTGTTCTCATGGTCC GTCCCCAGGACCCCCAAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 220} {0: 1, 1: 1, 2: 2, 3: 29, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!