ID: 901250116_901250126

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901250116 901250126
Species Human (GRCh38) Human (GRCh38)
Location 1:7771510-7771532 1:7771537-7771559
Sequence CCGAGGCCTGGGGGTGGGCGGTG TTGGGTCGCGGGCTGCAGACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 78, 4: 686} {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!