ID: 901352734_901352738

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 901352734 901352738
Species Human (GRCh38) Human (GRCh38)
Location 1:8612254-8612276 1:8612302-8612324
Sequence CCAGCAGCTCTCTCATTACACTG TTTATGAGAACTCCACATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 143} {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!