ID: 901361323_901361333

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 901361323 901361333
Species Human (GRCh38) Human (GRCh38)
Location 1:8703278-8703300 1:8703298-8703320
Sequence CCGCGCGGGGCCCCGCCCGCGGC GGCTAGGGAGGCGGCCGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 90, 4: 591} {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!