ID: 901451682_901451687

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901451682 901451687
Species Human (GRCh38) Human (GRCh38)
Location 1:9339931-9339953 1:9339958-9339980
Sequence CCCTCCACCTTTTCCTTCTGATG TTTCCTCCAGCCCCCCACCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 625} {0: 1, 1: 0, 2: 6, 3: 38, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!