ID: 901468976_901468979

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 901468976 901468979
Species Human (GRCh38) Human (GRCh38)
Location 1:9442407-9442429 1:9442425-9442447
Sequence CCATCAAGTATTTTAAGACCGAA CCGAAGCTTCACATTCTCAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!