ID: 901494072_901494076

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 901494072 901494076
Species Human (GRCh38) Human (GRCh38)
Location 1:9611492-9611514 1:9611521-9611543
Sequence CCGGCCTCGAATGTTTAGATTTC CTCTTTCAATGTCAGAGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 85} {0: 1, 1: 1, 2: 0, 3: 10, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!