ID: 901520339_901520342

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 901520339 901520342
Species Human (GRCh38) Human (GRCh38)
Location 1:9778991-9779013 1:9779040-9779062
Sequence CCAGCCTGGGAGAGAAGCGAGAG AAGAAGAAGAAGAAGAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 401, 4: 4283} {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!