ID: 901522606_901522609

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 901522606 901522609
Species Human (GRCh38) Human (GRCh38)
Location 1:9796831-9796853 1:9796863-9796885
Sequence CCATTACATCAAATTTGAAAATA CAGAATGAACAGATGGAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 624} {0: 1, 1: 0, 2: 0, 3: 44, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!