ID: 901532676_901532686

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 901532676 901532686
Species Human (GRCh38) Human (GRCh38)
Location 1:9863475-9863497 1:9863505-9863527
Sequence CCAGCAGATCATCCGTGTGGCAC GTGCAAAGGAGGGGCCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46} {0: 1, 1: 0, 2: 1, 3: 21, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!