ID: 901559584_901559592

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 901559584 901559592
Species Human (GRCh38) Human (GRCh38)
Location 1:10059479-10059501 1:10059509-10059531
Sequence CCTTGGGAGGCTCTCCCGGAAGG ATGGAGCTGAGCCTGCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 155} {0: 1, 1: 2, 2: 9, 3: 36, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!