ID: 901563301_901563305

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 901563301 901563305
Species Human (GRCh38) Human (GRCh38)
Location 1:10090496-10090518 1:10090511-10090533
Sequence CCTAGATATTCTTATCTGTAAAA CTGTAAAAGAGGAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 202, 4: 1672} {0: 1, 1: 0, 2: 13, 3: 144, 4: 722}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!