ID: 901631080_901631090

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 901631080 901631090
Species Human (GRCh38) Human (GRCh38)
Location 1:10648435-10648457 1:10648486-10648508
Sequence CCTCTTCCTTCCAGAACCTGCTC TTCACAGCAGGCTTCCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 506} {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!