ID: 901633094_901633103

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 901633094 901633103
Species Human (GRCh38) Human (GRCh38)
Location 1:10657340-10657362 1:10657364-10657386
Sequence CCACAGCCTCGGTGACGGCCGGC GTGGGGAGGCCACTCTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 184} {0: 1, 1: 0, 2: 1, 3: 38, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!