ID: 901701299_901701304

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 901701299 901701304
Species Human (GRCh38) Human (GRCh38)
Location 1:11045995-11046017 1:11046036-11046058
Sequence CCTCGGCCCCTGCGTCGTTTTTG GGAGTCTAGCTCTGTCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76} {0: 392, 1: 32093, 2: 86068, 3: 131309, 4: 146054}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!