ID: 901771220_901771231

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 901771220 901771231
Species Human (GRCh38) Human (GRCh38)
Location 1:11531325-11531347 1:11531358-11531380
Sequence CCAGGGGCTGGCCCCACAGCCAA GTCACCACCGGGGTGTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 386} {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!