ID: 901815898_901815900

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 901815898 901815900
Species Human (GRCh38) Human (GRCh38)
Location 1:11793502-11793524 1:11793517-11793539
Sequence CCAGGCTGGAGTGCAGAGGCACA GAGGCACAAATATGGCTTACTGG
Strand - +
Off-target summary {0: 267, 1: 27687, 2: 90133, 3: 180933, 4: 210949} {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!