ID: 901821982_901821987

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 901821982 901821987
Species Human (GRCh38) Human (GRCh38)
Location 1:11836073-11836095 1:11836097-11836119
Sequence CCGGTGGTCACAGAGAACCGCGG AACGAGAAGGAGTTCATGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!