ID: 901836390_901836393

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 901836390 901836393
Species Human (GRCh38) Human (GRCh38)
Location 1:11926429-11926451 1:11926452-11926474
Sequence CCGGCGGTCAAGCGTCGCCGTGT CTTTTACGACAGATGGAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 10} {0: 1, 1: 0, 2: 0, 3: 11, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!