ID: 901839569_901839578

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 901839569 901839578
Species Human (GRCh38) Human (GRCh38)
Location 1:11945365-11945387 1:11945398-11945420
Sequence CCATGAGCCATGATTGTGCCTCT CTGGGCAACGGGAGTGAGATTGG
Strand - +
Off-target summary {0: 2, 1: 57, 2: 237, 3: 689, 4: 1842} {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!