ID: 901847579_901847588

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 901847579 901847588
Species Human (GRCh38) Human (GRCh38)
Location 1:11993609-11993631 1:11993642-11993664
Sequence CCTGTAGTCCCAGCTACTTGGGA GGAGAATGGTGTGAACCCCAGGG
Strand - +
Off-target summary {0: 41425, 1: 153414, 2: 219429, 3: 225665, 4: 454725} {0: 13, 1: 341, 2: 584, 3: 1091, 4: 1727}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!