ID: 901862452_901862459

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 901862452 901862459
Species Human (GRCh38) Human (GRCh38)
Location 1:12083379-12083401 1:12083426-12083448
Sequence CCAAAAAGTGGAATGTCTATCGA TACCTGTAATCCCAGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81} {0: 4761, 1: 166787, 2: 306278, 3: 212252, 4: 197042}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!