ID: 901864945_901864947

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 901864945 901864947
Species Human (GRCh38) Human (GRCh38)
Location 1:12099695-12099717 1:12099727-12099749
Sequence CCTAGATTAGTGTACTTACACAC ATGTAGCCTACTGCACACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98} {0: 2, 1: 16, 2: 174, 3: 661, 4: 1330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!