|
Left Crispr |
Right Crispr |
| Crispr ID |
901882993 |
901882998 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:12204885-12204907
|
1:12204916-12204938
|
| Sequence |
CCTGGTCTGGCCAGGCAAGGTGG |
TGTAATCTCAGTACTTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 32, 3: 245, 4: 1078} |
{0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|