ID: 901887003_901887010

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 901887003 901887010
Species Human (GRCh38) Human (GRCh38)
Location 1:12230266-12230288 1:12230286-12230308
Sequence CCCGTCGTCCGGCCTCGGTCTGA TGAGCCCCTCGGGGTAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38} {0: 1, 1: 0, 2: 1, 3: 17, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!