ID: 901905636_901905639

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 901905636 901905639
Species Human (GRCh38) Human (GRCh38)
Location 1:12407148-12407170 1:12407162-12407184
Sequence CCTGTAGTTTTAAACATTGTCCC CATTGTCCCAAGAGGGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147} {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!