ID: 901977213_901977223

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 901977213 901977223
Species Human (GRCh38) Human (GRCh38)
Location 1:13004701-13004723 1:13004747-13004769
Sequence CCCTAGCTGATGTCCCTAGACCT TCTCTTCCACTGGGCTCCTGTGG
Strand - +
Off-target summary {0: 10, 1: 2, 2: 4, 3: 5, 4: 98} {0: 3, 1: 0, 2: 2, 3: 34, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!