ID: 902189109_902189111

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 902189109 902189111
Species Human (GRCh38) Human (GRCh38)
Location 1:14748717-14748739 1:14748738-14748760
Sequence CCTGTGCTGAAGACTAAATGAGG GGCAATGTATGTGAAGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 129} {0: 1, 1: 0, 2: 3, 3: 22, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!