ID: 902237663_902237682

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 902237663 902237682
Species Human (GRCh38) Human (GRCh38)
Location 1:15068206-15068228 1:15068256-15068278
Sequence CCCCTCTGGGAGGCACAGGCTGG CTGGGTTCTGGGAGGGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 258, 4: 2850} {0: 1, 1: 0, 2: 5, 3: 158, 4: 2196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!