ID: 902241919_902241925

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 902241919 902241925
Species Human (GRCh38) Human (GRCh38)
Location 1:15095191-15095213 1:15095215-15095237
Sequence CCAATGCGGGAACCTCACGAGCC CCCAGCACTCCTCTGCCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31} {0: 1, 1: 0, 2: 8, 3: 64, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!