ID: 902295501_902295509

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 902295501 902295509
Species Human (GRCh38) Human (GRCh38)
Location 1:15464077-15464099 1:15464120-15464142
Sequence CCTACATCACAGAGTTGTCACGA TAGGAAGCCCAGAATGGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 8, 3: 60, 4: 416} {0: 1, 1: 0, 2: 2, 3: 26, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!