ID: 902350024_902350028

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 902350024 902350028
Species Human (GRCh38) Human (GRCh38)
Location 1:15847628-15847650 1:15847647-15847669
Sequence CCTTGGCAGGCGGGAGGACGCGC GCGCGCGCGCCCGCGGCGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 35, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!