ID: 902365324_902365331

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 902365324 902365331
Species Human (GRCh38) Human (GRCh38)
Location 1:15969445-15969467 1:15969470-15969492
Sequence CCTGGTGCCAAAAAGGTTGGGGG GCGGGCCATGCCACGGCTGGTGG
Strand - +
Off-target summary {0: 46, 1: 995, 2: 1690, 3: 1497, 4: 961} {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!