ID: 902374486_902374494

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 902374486 902374494
Species Human (GRCh38) Human (GRCh38)
Location 1:16023864-16023886 1:16023907-16023929
Sequence CCTCGGGGTGCTCATGGCCCTGG GCCATCGGGTGTGTGGTCCGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 24, 4: 249} {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!